View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11740_high_35 (Length: 244)
Name: NF11740_high_35
Description: NF11740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11740_high_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 170
Target Start/End: Complemental strand, 46676723 - 46676553
Alignment:
| Q |
1 |
aactccagcttcaaagctacacagaagaggatgcaattgcaggaaatcaagctgcatgaagaattattgcaaatgttgagannnnnnn-ccattgtttac |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46676723 |
aactccagcttcaaagctacacagaagaggatgcaattgcaggaaatcaagctgcatgaagaattattgcaaatgttgaggttttttttccattgtttac |
46676624 |
T |
 |
| Q |
100 |
atatcatgtatatttttaatttcatttataataatatgaattacaatgggtggttttcttttgaagaaaca |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46676623 |
atatcatgtatatttttaatttcatttataataatatgaattacaatgggtggttttcttttgaagaaaca |
46676553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 89 - 165
Target Start/End: Complemental strand, 46702786 - 46702710
Alignment:
| Q |
89 |
ccattgtttacatatcatgtatatttttaatttcatttataataatatgaattacaatgggtggttttcttttgaag |
165 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46702786 |
ccattgtttacatattatgtatgtttttaatttcatttataataatatgaattacaatggatggttttcttttgaag |
46702710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University