View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11740_high_39 (Length: 221)
Name: NF11740_high_39
Description: NF11740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11740_high_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 7e-82; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 27 - 184
Target Start/End: Original strand, 28716544 - 28716701
Alignment:
| Q |
27 |
cataggattaggaggttagaacacaattataagagagaatgaattgttcgggaaataatatagtgaacaagagggtgcaacataagattgaacaaaaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28716544 |
cataggattaggaggttagaacacaattataagagagaatgaattgttctggaaataatatagtgaacaagagggtgcaacataagattgaacaaaaaca |
28716643 |
T |
|
| Q |
127 |
aactcgctcatcaatctcacttggtactctctcatgcttactttcacttccttccatg |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28716644 |
aactcgctcatcaatctcacttggtactctctcatgcttactttcacttccttccatg |
28716701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 124 - 184
Target Start/End: Original strand, 28705045 - 28705105
Alignment:
| Q |
124 |
acaaactcgctcatcaatctcacttggtactctctcatgcttactttcacttccttccatg |
184 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28705045 |
acaaacttgctcaccaatctcacttggtactctctcacgcttactttcacttccttccatg |
28705105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 38 - 89
Target Start/End: Original strand, 28710977 - 28711028
Alignment:
| Q |
38 |
gaggttagaacacaattataagagagaatgaattgttcgggaaataatatag |
89 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28710977 |
gaggttagaacaaaattataagagagaatgaattgttcttcaaataatatag |
28711028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 133 - 177
Target Start/End: Original strand, 28711052 - 28711096
Alignment:
| Q |
133 |
ctcatcaatctcacttggtactctctcatgcttactttcacttcc |
177 |
Q |
| |
|
|||| ||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
28711052 |
ctcaccaatctcacttggtattctctcacgcttactttcacttcc |
28711096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University