View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11740_high_41 (Length: 205)
Name: NF11740_high_41
Description: NF11740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11740_high_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 44457538 - 44457725
Alignment:
| Q |
1 |
ttgttcatttcttagtattagaatgaaaagggtttttcactgtctagcactgacacatctattgaaggtgtatcccatgtttgacacctttcagtgtttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44457538 |
ttgttcatttcttagtattagaatgaaaagggtttttcactgtctagcactgacacatctattgaaggtgtatcccatgtttgacacgtttcagtgtttg |
44457637 |
T |
 |
| Q |
101 |
acatagacgaaaatggttaaattcagttaaatcannnnnnncaaattattatttttgtcgacgagtctgtgttgtgtccggtatctgtg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44457638 |
acatagacgaaaatggttaaattcagttaaatca-ttttttcaaattattatttttgtcgacgagtctgtgttgtgtccggtatttgtg |
44457725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University