View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11740_low_24 (Length: 356)
Name: NF11740_low_24
Description: NF11740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11740_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 22 - 234
Target Start/End: Complemental strand, 48171260 - 48171048
Alignment:
| Q |
22 |
ccttctcaacctctcaatctcaccttcaagaccaaactcccctaattcaatacaagaaccaccggtttcttgctgcatagcttgtgattgtgtcaaattt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48171260 |
ccttctcaacctctcaatctcaccttcaagaccaaactcccctaattcaatacaggaaccaccggtttcttgctgcatagcttgtgattgtgtcaaattt |
48171161 |
T |
|
| Q |
122 |
cttcttctcttgattgttttcaacaagttcctctgtccagccaaaaacccttcgttcgcaaactcccatcgatccggatcaacttttctaaaaccctgca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48171160 |
cttcttctcttgattgttttcaacaagttcctctgtccagccaaaaacccttcgttcgcaaactcccatcgatccggatcaacttttctaaaaccctgca |
48171061 |
T |
|
| Q |
222 |
tatgaacagacat |
234 |
Q |
| |
|
||||||||||||| |
|
|
| T |
48171060 |
tatgaacagacat |
48171048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 259 - 340
Target Start/End: Complemental strand, 48170991 - 48170897
Alignment:
| Q |
259 |
acacaaacaccggatacatcgacattggtaataatgaaagta-------------attatatgtgtggactgagctaactaataaataccaaatt |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48170991 |
acacaaacaccggatacatcgacattggtaataatgaaagtaattccatgtaattattatatgtgtggactgagctaactaataaataccaaatt |
48170897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University