View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11740_low_37 (Length: 260)
Name: NF11740_low_37
Description: NF11740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11740_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 18 - 247
Target Start/End: Original strand, 48708314 - 48708542
Alignment:
| Q |
18 |
acaagtactatgaagtcaaaattaatagggtcgaagttannnnnnnnnacttgctatatatgctagtgtagtgaatttcacccaacaaacagaagaaagc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48708314 |
acaagtactatgaagtcaaaattaatagggtcgaagttatttttttttacttgctatatatgctagtgtagtgaatttcacccaacaaaaagaagaaagc |
48708413 |
T |
|
| Q |
118 |
ttttt-atacttctcttatgtgactcactatactacactagtatagaaagcttagatctgtcatgcaatgataactttgactatctttttagatctgaaa |
216 |
Q |
| |
|
||||| ||||||||||| || |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48708414 |
ttttttatacttctcttttg--actcactatactacactagtatagaaagcttagatctgccatgcaatgataactttgactatctttttagatctgaaa |
48708511 |
T |
|
| Q |
217 |
aaacagtgtcccttcttgtttttcttcctct |
247 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |
|
|
| T |
48708512 |
aaacagcgtcccttcttgtttttcttcctct |
48708542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University