View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11740_low_38 (Length: 259)
Name: NF11740_low_38
Description: NF11740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11740_low_38 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 60 - 259
Target Start/End: Original strand, 2693345 - 2693536
Alignment:
| Q |
60 |
aatgttcaatgtcgacaccaatatgtgtcagacacttgacacacattgacacatccaatctgaaatgccgaaagtctcggtgttacatttttaactatat |
159 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||| ||||| |||||||||||||| ||||||||||| ||||||||||| |||| |||| |
|
|
| T |
2693345 |
aatgttcaatgtcaacaccaatatgtgtcggacactttgcacac--------atccaatctgaaataccgaaagtctcagtgttacatttctaaccatat |
2693436 |
T |
 |
| Q |
160 |
aatttcagtacactaagactaagttaagtaggacatgtattaatttttatgcaggtcaggctgaagaagtacatggaaatgagaggtgctgatggggggc |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2693437 |
aatttcagtacactaagactaagttaagtaggacatgtattaatttttatgcaggtcaggctaaagaagtacatggaaatgagaggtgctgatggggggc |
2693536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University