View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11741_high_8 (Length: 280)
Name: NF11741_high_8
Description: NF11741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11741_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 5831136 - 5830874
Alignment:
| Q |
1 |
aatcaagaggtaagttatcaattctcctcattttcgtttttagttcacattttcctctgtttatgtccaacttgtacaattcgaatgttggttgtatcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5831136 |
aatcaagaggtaagttatcaattctcctcattttcgtttttagttcacattttcctctgtttatgtccaacttgtacaattcgaatgttggttgtatcta |
5831037 |
T |
 |
| Q |
101 |
tattggccaatccaggcactacgcatgttatttttacgttgctttctcaggtttatgtgttgtatgtagagtttataattgtgtttggttttcctttgtt |
200 |
Q |
| |
|
||||||||||||||| ||||| ||||||||| ||| | ||||||||| ||||||| ||| |||||||| ||||||||||||||||| |||||| ||||| |
|
|
| T |
5831036 |
tattggccaatccagacactatgcatgttatgttttccttgctttctgaggttta--tgtcgtatgtagggtttataattgtgtttgcttttcccttgtt |
5830939 |
T |
 |
| Q |
201 |
tcaataatggagagaattcctgatgcacatcgtattaggcaaggcagagttacatcgactgcctt |
265 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5830938 |
tcaataatggagagaattactgatgcacatcgtattaggcaaggcagagttacatcggctgcctt |
5830874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University