View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11741_low_14 (Length: 252)
Name: NF11741_low_14
Description: NF11741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11741_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 6 - 191
Target Start/End: Original strand, 5134086 - 5134271
Alignment:
| Q |
6 |
tgcaatgagatgaagcaccaggtgaaatgttcaaccgaacattgaataatatcttcttccatagctccatttcagcttcaaatgtatttgaattaagaag |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5134086 |
tgcaatgacatgaagcaccaggtgaaatgttcaaccgaacatcgaataatatcttcttccatagctccatttcagcttcaaatgtatttgaattaagaag |
5134185 |
T |
 |
| Q |
106 |
gtgtctcatatcaacccagcaaaacaaaccagcattatttgtttcgagacaactaatacctgctttttgtaatccattaacaagca |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5134186 |
gtgtctcatatcaacccagcaaaacaaaccagcattatttgtttcgagacaactaatacctgctttttgtaatccattaacaagca |
5134271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 22 - 129
Target Start/End: Complemental strand, 40208444 - 40208337
Alignment:
| Q |
22 |
accaggtgaaatgttcaaccgaacattgaataatatcttcttccatagctccatttcagcttcaaatgtatttgaattaagaaggtgtctcatatcaacc |
121 |
Q |
| |
|
||||||||||||||| || | ||| | | | | ||| ||||||||||| |||||||||||||||||||| || |||| ||||| || |||||||||||| |
|
|
| T |
40208444 |
accaggtgaaatgtttaaaccaacttggtacactattttcttccatagttccatttcagcttcaaatgtgttggaatggagaagatgcctcatatcaacc |
40208345 |
T |
 |
| Q |
122 |
cagcaaaa |
129 |
Q |
| |
|
|| ||||| |
|
|
| T |
40208344 |
caacaaaa |
40208337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University