View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11742_low_14 (Length: 203)
Name: NF11742_low_14
Description: NF11742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11742_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 17 - 187
Target Start/End: Complemental strand, 14208415 - 14208247
Alignment:
| Q |
17 |
agagatttagttgggatgaagaagatgattatatatttgtttaatatgaggcggtgaaagaagagacaaatgattagatattttaggatgaggatgaaga |
116 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
14208415 |
agagatttagttgggatgaagaagacgattatatatttgtttaatatgaggcggtggaagaagagacaaataattagatattttaagatgaggatgaaga |
14208316 |
T |
|
| Q |
117 |
agagccnnnnnnnnnnnttaatctttcaatttggtccctatgacgtgtcgttgcgtatatggggtttaaat |
187 |
Q |
| |
|
||| || ||||||||||| ||||| ||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
14208315 |
agaccc--aaaaaaaaattaatctttcagtttggcccctatgacatgtcgttgtgtatatggggtttaaat |
14208247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University