View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11742_low_2 (Length: 535)
Name: NF11742_low_2
Description: NF11742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11742_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 2e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 2e-63
Query Start/End: Original strand, 225 - 348
Target Start/End: Complemental strand, 43513781 - 43513658
Alignment:
| Q |
225 |
acgttaccggctatctctcatttcaaaatcgcgctcagaacgacttctactcctccgagacctatctctctcctcccgttctctctccctgtctcgttca |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43513781 |
acgttaccggctatctctcatttcaaaatcgcgctcagaacgacttctactcctccgagacctatctctctcctcccgttctctctccctgtctcgttca |
43513682 |
T |
|
| Q |
325 |
gaacggcttatgcttctccgagac |
348 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43513681 |
gaacggcttatgcttctccgagac |
43513658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 18 - 129
Target Start/End: Complemental strand, 43513988 - 43513877
Alignment:
| Q |
18 |
catcaaaccaacagtcaattttagctgcagcattgttgataaacaacacaattgttcatttagcaatcaaaataaacaattctcaccaaatgctgtcgac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43513988 |
catcaaaccaacagtcaattttagctgcagcattgttgataaacaacacaattgttcatttggcaatcaaattaaacaattctcaccaaatgctgtcgac |
43513889 |
T |
|
| Q |
118 |
taaacctaacct |
129 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43513888 |
taaacctaacct |
43513877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University