View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11742_low_9 (Length: 288)
Name: NF11742_low_9
Description: NF11742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11742_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 284
Target Start/End: Original strand, 4771211 - 4771500
Alignment:
| Q |
1 |
tgttcattagtgtaagctaaacctctgttatctccaccgtaaacattggagttatcactatgttttccattactagtaacccataaaaattacttcctta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
4771211 |
tgttcattagtgtaagctaaacctctgttatctccaccataaacattggagttatcactatgttttccattactagtaacccgtaaaaattacttgctta |
4771310 |
T |
 |
| Q |
101 |
taattggatcttgaatcagattcttaactg---ataatataacttttcttcttatttattcttggatcccattcactcttttgcaaacactaaacttgac |
197 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4771311 |
aaattggatcttgaatcagattcttaactgataataatataacttttcttcttatttattcttggatcccattcactcttttgcaaacactaaaccggac |
4771410 |
T |
 |
| Q |
198 |
catttc---tactttttgcgtttggctttggtgatcttctaatgattggtggaactctttgagtaccgttactatctcacatctctgctt |
284 |
Q |
| |
|
|||| | ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
4771411 |
cattgctcgtactttttgcgtttggccttggtgatcttctaatgattggtggaactctttgagtaccgttactatctcgcatctttgctt |
4771500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 2140705 - 2140652
Alignment:
| Q |
28 |
ttatctccaccgtaaacattggagttatcactatgttttccattactagtaacc |
81 |
Q |
| |
|
||||||||| | ||||||| || |||| |||||||||||||||||||||||||| |
|
|
| T |
2140705 |
ttatctccatcataaacatgggggttaccactatgttttccattactagtaacc |
2140652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University