View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11743_high_28 (Length: 243)

Name: NF11743_high_28
Description: NF11743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11743_high_28
NF11743_high_28
[»] chr4 (2 HSPs)
chr4 (98-243)||(37791431-37791585)
chr4 (18-65)||(37791587-37791634)


Alignment Details
Target: chr4 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 98 - 243
Target Start/End: Complemental strand, 37791585 - 37791431
Alignment:
98 ggggaatatctcattttggttccggattcagtgacaacttactaatatgtgcgctcnnnnnnnnnnncttc---------caggaatgaaggctttgtcc 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||            ||          ||||||||||||||||||||    
37791585 ggggaatatctcattttggttccggattcagtgacaacttactaatatgtgtgctcttttttttttttttttttttttttcaggaatgaaggctttgtcc 37791486  T
189 gcgaaggttaaatttaaccagaaaaagtaatcataaatgaaatgtaaatgatcct 243  Q
    |||||||||||||||||| |||||||| ||||| |||||||||||||||||||||    
37791485 gcgaaggttaaatttaacaagaaaaagaaatcagaaatgaaatgtaaatgatcct 37791431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 37791634 - 37791587
Alignment:
18 gtacccataataactgtcacttaagatatcggtaattttttcaatata 65  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||    
37791634 gtacccataataactgtcacttaagatatccgtaattttttcaatata 37791587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University