View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11743_high_28 (Length: 243)
Name: NF11743_high_28
Description: NF11743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11743_high_28 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 98 - 243
Target Start/End: Complemental strand, 37791585 - 37791431
Alignment:
| Q |
98 |
ggggaatatctcattttggttccggattcagtgacaacttactaatatgtgcgctcnnnnnnnnnnncttc---------caggaatgaaggctttgtcc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
37791585 |
ggggaatatctcattttggttccggattcagtgacaacttactaatatgtgtgctcttttttttttttttttttttttttcaggaatgaaggctttgtcc |
37791486 |
T |
|
| Q |
189 |
gcgaaggttaaatttaaccagaaaaagtaatcataaatgaaatgtaaatgatcct |
243 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
37791485 |
gcgaaggttaaatttaacaagaaaaagaaatcagaaatgaaatgtaaatgatcct |
37791431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 37791634 - 37791587
Alignment:
| Q |
18 |
gtacccataataactgtcacttaagatatcggtaattttttcaatata |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37791634 |
gtacccataataactgtcacttaagatatccgtaattttttcaatata |
37791587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University