View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11743_high_34 (Length: 206)
Name: NF11743_high_34
Description: NF11743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11743_high_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 18 - 162
Target Start/End: Original strand, 34583344 - 34583488
Alignment:
| Q |
18 |
atttctagctggcatttggtggaattggaaagctagaaacattgtttgtgagggaaatgactcaattgagctgttttccgtggcgtccgatgctagaaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34583344 |
atttctagctggcatttggtggaattggaaagctagaaacattgtttgtgagggaaatgactcaattgagctgttttccgtggcgtccgatgctagaaga |
34583443 |
T |
 |
| Q |
118 |
ctttcttatcgcttattagtttgcttccccataaataccttgcac |
162 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34583444 |
ctttcgaatcacttattagtttgcttccccataaataccttgcac |
34583488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 32 - 147
Target Start/End: Complemental strand, 13753528 - 13753413
Alignment:
| Q |
32 |
tttggtggaattggaaagctagaaacattgtttgtgagggaaatgactcaattgagctgttttccgtggcgtccgatgctagaagactttcttatcgctt |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| ||| || |||||||||||||| | || ||| |
|
|
| T |
13753528 |
tttggtggaattggaaagctagaaacattgtttgtgtgggaaatgactctattgagctgttttccgtggtgtctgaggctagaagactttcgtctctctt |
13753429 |
T |
 |
| Q |
132 |
attagtttgcttcccc |
147 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
13753428 |
atcagtttgcttcccc |
13753413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University