View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11743_low_26 (Length: 249)
Name: NF11743_low_26
Description: NF11743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11743_low_26 |
 | |
|
| [»] scaffold0179 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0179 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 19 - 168
Target Start/End: Original strand, 2102 - 2251
Alignment:
| Q |
19 |
atatactcatcacaaccctctagtttctctgtaacttaatggccgcaagnnnnnnnnntggagagtttttattgtctgtgaggttcactttcattgctgg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2102 |
atatactcatcacaaccctctagtttctctgtaacttaatggccgcaagaaaaaaaaatggacagtttttattgtctgtgaggttcactttcattgttgg |
2201 |
T |
|
| Q |
119 |
ggtagcaattatgctgcagaagctacagttattagcccctaaaccaaatt |
168 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2202 |
ggtagcaattatgctgcagaaggtacagttattagcccctaaaccaaatt |
2251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 178 - 236
Target Start/End: Original strand, 2297 - 2355
Alignment:
| Q |
178 |
gttatttaggtaggggagggtccaggtgagaggcaataaaacagtggttagtctctctg |
236 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
2297 |
gttatttaggtaggggagggtctaggtgagagccattaaaaaagtggttagtctctctg |
2355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University