View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11743_low_29 (Length: 242)
Name: NF11743_low_29
Description: NF11743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11743_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 5820176 - 5819951
Alignment:
| Q |
1 |
tatttatagtcataatcatattatttatttataagcacacaataaatttgcgtttatttgtagtgttcatgccttgctcatttacacatttaacataacc |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5820176 |
tatttatagtcataatcatattatttacttataagcacacaataaatttgcgtttatttgtagtgttcatgccttgctcatttacacatttaacataacc |
5820077 |
T |
 |
| Q |
101 |
ttttttaagaaggaacccatttattttcttattccaagatctagatgtctatttcaggatatagagtgattttctcaacttgtaaacacaatttattttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5820076 |
ttttttaagaaggaacccatttattttcttattccaagatctagatgtctatttcaggatatagagtgattttctcaacttgtaaacacaatttattttc |
5819977 |
T |
 |
| Q |
201 |
cttttacctcaaaacctagtggttga |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
5819976 |
cttttacctcaaaacctagtggttga |
5819951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 75 - 154
Target Start/End: Complemental strand, 29997319 - 29997240
Alignment:
| Q |
75 |
tgctcatttacacatttaacataaccttttttaagaaggaacccatttattttcttattccaagatctagatgtctattt |
154 |
Q |
| |
|
||||||||||||||||| ||| | |||| || |||||||||||||| ||||||||| ||||||| ||||| ||||||||| |
|
|
| T |
29997319 |
tgctcatttacacatttcacaaatccttgttgaagaaggaacccatctattttcttgttccaagctctagctgtctattt |
29997240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University