View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11743_low_33 (Length: 231)
Name: NF11743_low_33
Description: NF11743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11743_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 17 - 215
Target Start/End: Original strand, 51033509 - 51033705
Alignment:
| Q |
17 |
agatgttgtgagaccagcaattccagctcccacaatcacaatatcttcttccataactaactatttagtaaattttccttttgccttctcttgtgcaaag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51033509 |
agatgttgtgagaccagcaattccagctcccacaatcacaatatcttcttccataactaacaatttagtaaattttctttttgccttctcttgtgcaaag |
51033608 |
T |
|
| Q |
117 |
tatattataatagtatactaagcnnnnnnnnnngggtaggataga-gggacagaagcttgctttgggtaaggataatgcttcaaagaacaatgctgcaag |
215 |
Q |
| |
|
|| |||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
51033609 |
ta---tataatagtatactaagcttttttttttgggtaggatagaggggacagaagcttgctttgggtaaggataatgcttcaaagaacaatactgcaag |
51033705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 40611799 - 40611750
Alignment:
| Q |
18 |
gatgttgtgagaccagcaattccagctcccacaatcacaatatcttcttc |
67 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40611799 |
gatgttgtgaggccagcaattccagctcccacaatcacaatatcttcttc |
40611750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 51036918 - 51036967
Alignment:
| Q |
18 |
gatgttgtgagaccagcaattccagctcccacaatcacaatatcttcttc |
67 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51036918 |
gatgttgtgagtccagcaattccagctcccacaatcacaatatcttcttc |
51036967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 63
Target Start/End: Original strand, 51067562 - 51067607
Alignment:
| Q |
18 |
gatgttgtgagaccagcaattccagctcccacaatcacaatatctt |
63 |
Q |
| |
|
||||||||||| ||||||||||||||||| || ||||||||||||| |
|
|
| T |
51067562 |
gatgttgtgaggccagcaattccagctcctacgatcacaatatctt |
51067607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 30 - 67
Target Start/End: Original strand, 51070205 - 51070242
Alignment:
| Q |
30 |
ccagcaattccagctcccacaatcacaatatcttcttc |
67 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51070205 |
ccagcaattccagctcccacaatcacaacatcttcttc |
51070242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University