View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11744_high_26 (Length: 225)
Name: NF11744_high_26
Description: NF11744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11744_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 37 - 210
Target Start/End: Complemental strand, 23876135 - 23875962
Alignment:
| Q |
37 |
cggttaatatgtatgaaaatgttttaccaacaagtggctaaattgaataataatatcaacacttgccaagtagttcgctttcacaatttccactactgca |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
23876135 |
cggttaatatgtatgaaaatgttttaccaacaggtggctaaattgaataataatatcaacacttgccaagtagctctctttcacaatttccactactgca |
23876036 |
T |
 |
| Q |
137 |
gtcactgtctgatgcaacaccaagtccctcaaagcctccctttgacgtttctgaaactaagatatgatattgat |
210 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
23876035 |
gtcactgtctgacgcaacaccaagtccttcaaagcctccctttgacgtttctggaaccaagatatgatattgat |
23875962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University