View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11744_low_21 (Length: 244)
Name: NF11744_low_21
Description: NF11744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11744_low_21 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 16 - 244
Target Start/End: Complemental strand, 32814097 - 32813869
Alignment:
| Q |
16 |
aatttgatttgatgtttttctcccatcaatctttagaattaattcggccggttagggagtcctttgtcgttctatagcttgttgttgttttcagattctt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32814097 |
aatttgatttgatgtttttctcccatcaatctttagaattaattcggccggttagggagtcctttgttgttctatagcttgttgttgttttcagattctt |
32813998 |
T |
 |
| Q |
116 |
agtagggtttagtgggatggccgcccatggaatcgtgctgagaatggggaatgacaacattctcgagaaaaaagttcaaggtcagttttgaaaaatgatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32813997 |
agtagggtttagtgggatggccgcccatggaatcgtgctgagaatggggaatgacaacattctcgagaaaaaagttcaaggtcagttttgaaaaatgatt |
32813898 |
T |
 |
| Q |
216 |
ttcctgctagcataatccctttagtttcc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32813897 |
ttcctgctagcataatccctttagtttcc |
32813869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 79 - 217
Target Start/End: Complemental strand, 42163086 - 42162948
Alignment:
| Q |
79 |
ttgtcgttctatagcttgttgttgttttcagattcttagtagggtttagtgggatggccgcccatggaatcgtgctgagaatggggaatgacaacattct |
178 |
Q |
| |
|
|||||||||| ||| || |||||||||||| ||||| | ||||||||||||||| | ||||||| |||||| ||||||||||||||||||||||||| || |
|
|
| T |
42163086 |
ttgtcgttctgtagttttttgttgttttcatattctaactagggtttagtgggacgaccgcccagggaatcatgctgagaatggggaatgacaacatcct |
42162987 |
T |
 |
| Q |
179 |
cgagaaaaaagttcaaggtcagttttgaaaaatgatttt |
217 |
Q |
| |
|
|| || |||| | ||| | |||||||||||||||||| |
|
|
| T |
42162986 |
ggataacaaagcttaagttttgttttgaaaaatgatttt |
42162948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University