View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11744_low_22 (Length: 243)
Name: NF11744_low_22
Description: NF11744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11744_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 7341463 - 7341669
Alignment:
| Q |
1 |
ttctccctacacagtttatatgattatctaggtagtgctttatatgtgatcaaattaatttacttttaatcaagtgcaatttgtaacttttaaaatgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7341463 |
ttctccctacacagtttatatgattatctaggtagtgctttatatgtgatcaaattaatttacttttaatcaagtgcaatttgtaacttttaaaatgaat |
7341562 |
T |
 |
| Q |
101 |
ttcgccataaccaatagggttgggtttagcggaaggaactaaactcccaaacaacatgacacaataaggttcaaatt-----ggaaagagatatcaatat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7341563 |
ttcgccataaccaatagggttgggtttagcggaaggaactaaactcccacacaacatgacacaataaggttcaaattcggacggaaagagatatcaatat |
7341662 |
T |
 |
| Q |
196 |
tttaacc |
202 |
Q |
| |
|
||||||| |
|
|
| T |
7341663 |
tttaacc |
7341669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University