View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11744_low_31 (Length: 216)
Name: NF11744_low_31
Description: NF11744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11744_low_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 11 - 200
Target Start/End: Original strand, 48932334 - 48932524
Alignment:
| Q |
11 |
caaaggtgatcttgtggaccaaagagtggtacacacaga-acatgctgtggagtttgcagaggatcagggccnnnnnnnctcagagacttcagctttgag |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48932334 |
caaaggtgatcttgtggaccaaagagtggtacacacagacaaatgctgtggagtttgcagaggatcagggcctttttttctcagagacttcagctttgag |
48932433 |
T |
|
| Q |
110 |
tggtgaaaatgtcaactctgcatttttcaaattgcttcaagagattaataaggttgtctcaaaaaggtcgttggaatctaataatggtaag |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48932434 |
tggtgaaaatgtgaactctgcatttttcaaattgcttcaagagattaataaggttgtctcaaaaaggtcgttggaatctaataatggtaag |
48932524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University