View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_high_116 (Length: 322)
Name: NF11745_high_116
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_high_116 |
 |  |
|
| [»] scaffold0024 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 165; Significance: 3e-88; HSPs: 3)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 17 - 189
Target Start/End: Complemental strand, 81632 - 81461
Alignment:
| Q |
17 |
aggggatgcaagctgtgtgaccattaaataagggcaaacaacccttagtatttaattaatgccaagaatactttcccttctctctcttacttcccattgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
81632 |
aggggatgcaagctgtgtgaccattaaataagggcaaacaacccttagtatttaattaatgccaagaatactttcccttctctctcttacttccca-tgt |
81534 |
T |
 |
| Q |
117 |
atatatctaccccaacacaccaactcaaatttcaacagcaaaaaactcattctaccattcatctagcttagta |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
81533 |
atatatctaccccaacacaccaactcaaatttcaacagcaaaaaactcattctaccattcatctagcttagta |
81461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 218 - 313
Target Start/End: Complemental strand, 81432 - 81337
Alignment:
| Q |
218 |
gttaaatagtgaaagaaaaatatggaagggtttgaagaagaaatttcagagccagtgagtcccacaggacaatatttgaacagctcttccctttgc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
81432 |
gttaaatagtgaaagaaaaatatggaagggtttgaagaagaaatttcagagccagtgagtcccacaggacaatatttgaacagctcttccctttgc |
81337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 239 - 307
Target Start/End: Complemental strand, 73633 - 73565
Alignment:
| Q |
239 |
atggaagggtttgaagaagaaatttcagagccagtgagtcccacaggacaatatttgaacagctcttcc |
307 |
Q |
| |
|
|||||||| ||||| ||||||||| ||||||||||||||| ||||| ||||||||||| ||||||||| |
|
|
| T |
73633 |
atggaaggatttgaggaagaaattgaagagccagtgagtccaacagggcaatatttgaatagctcttcc |
73565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University