View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_high_138 (Length: 279)
Name: NF11745_high_138
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_high_138 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 7 - 279
Target Start/End: Original strand, 27758616 - 27758900
Alignment:
| Q |
7 |
gatgtagatcaattcatgaaggattcggtagaaacagcaaagaagaaccccgata------------caacttccacacaaagggtccagcctatagcaa |
94 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27758616 |
gatgtagatcaatacatgaaggattcggtagaaatagcaaagaagaaccccgatacaacaaatgatacaacttccacacaaagggtccagcctatagcaa |
27758715 |
T |
 |
| Q |
95 |
cacagtaggaggattttgttccagaaacgcagctcaagcagcctcctttgcggttgtcacttcgcatagatggccaataatgcaaaaggaccttaaattg |
194 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||| ||||| |
|
|
| T |
27758716 |
cacagcaggaggattttgttccagaaacgcagctcaagcagcctcctttgtggttgtcacttcgcatagatgaccaataatgcaaaaggaacttgaattg |
27758815 |
T |
 |
| Q |
195 |
atcaagccttctttggctgctcaaaaaagatgacaaggaagctcccttcacactgtatttgaccgagaatcagcctatcataccc |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27758816 |
atcaagccttctttggctgctcaaaaaagatgacaaggaagctctcttcacactgtatttgactaagaatcagcctatcataccc |
27758900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University