View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_high_146 (Length: 266)
Name: NF11745_high_146
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_high_146 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 184 - 255
Target Start/End: Complemental strand, 34899696 - 34899625
Alignment:
| Q |
184 |
ctatcatggatgatcgaaatgttgacgacgatgagaaggagtctttggccgggttgagttctgttccacctc |
255 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899696 |
ctatcatggatgatcgaaatattgacgacgatgagaaggagtctttggccgggttgagttctgttccacctc |
34899625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 7 - 66
Target Start/End: Complemental strand, 34899871 - 34899812
Alignment:
| Q |
7 |
gccttacttcccggtcatcgatcctacgtacttccacctctctagggaacccctttagac |
66 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899871 |
gccttacttcccggtcatcaatcctacgtacttccacctctctagggaacccctttagac |
34899812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University