View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_high_153 (Length: 261)
Name: NF11745_high_153
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_high_153 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 17465626 - 17465382
Alignment:
| Q |
1 |
tcatccctcaactcaacagcaatgatgaatgatcttccagattgggtccaaaagttgttggtgctggctctggctcaacccatcatctggttggtcgagc |
100 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17465626 |
tcatctctcaactcaacaacaatgatgaatgatcttccagattgggtccaaaagttgttggtgctggctctggctcaacccatcatctggttggtcgagc |
17465527 |
T |
|
| Q |
101 |
actcggcacttggggatgctactccagaatggatcaagataatatctgtgacggttatacccatcatcttcctctatattggcctcgctttgaagcaagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17465526 |
actcggcacttggggatgctactccagaatggatcaagataatatctgtgacggttatacccatcatcttcctctatattggcctcgctttgaagcaagt |
17465427 |
T |
|
| Q |
201 |
acttgacccaaagattgccaaaaacataatccgattggtgctgct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17465426 |
acttgacccaaagattgccaaaaacataatccgattggtgctgct |
17465382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University