View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11745_high_165 (Length: 251)

Name: NF11745_high_165
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11745_high_165
NF11745_high_165
[»] chr6 (2 HSPs)
chr6 (9-156)||(34112734-34112881)
chr6 (9-156)||(12470314-12470462)
[»] chr3 (2 HSPs)
chr3 (9-156)||(34306471-34306618)
chr3 (116-159)||(8366222-8366265)
[»] chr7 (3 HSPs)
chr7 (82-157)||(33829827-33829902)
chr7 (82-159)||(37503380-37503456)
chr7 (114-156)||(24857354-24857396)
[»] chr5 (1 HSPs)
chr5 (174-250)||(31192373-31192448)
[»] chr4 (1 HSPs)
chr4 (116-156)||(25267846-25267886)
[»] chr2 (2 HSPs)
chr2 (114-156)||(8078499-8078541)
chr2 (99-156)||(21466414-21466471)


Alignment Details
Target: chr6 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 9 - 156
Target Start/End: Complemental strand, 34112881 - 34112734
Alignment:
9 tgagatgaaagtgcagataaaagttgagggtatgcaatnnnnnnnnctaagggggttcatagtgcnnnnnnnntggattattggtgtattttttaaaagt 108  Q
    |||| |||||||||||||||||||||||||||||||||        |||||||| ||||||||||        |||||||||||||||||||||||||||    
34112881 tgagttgaaagtgcagataaaagttgagggtatgcaataaaaaaaactaaggggattcatagtgcaaaaaaaatggattattggtgtattttttaaaagt 34112782  T
109 tgagaggatgcatgtgcatcccctaacttgtatgtggctccgccactg 156  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
34112781 tgagaggatgcatgtgcatcccctaacttgtatgtggctccgccactg 34112734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 9 - 156
Target Start/End: Complemental strand, 12470462 - 12470314
Alignment:
9 tgagatgaaagtgcagataaaagttgagggtatgcaatnnnnnnnnctaagggggttcatagtgcnnnnnnnnt-ggattattggtgtattttttaaaag 107  Q
    |||| |||||||||| ||||| ||||||||||||||||        |||||||||||||||||||        | ||||||||||||||||||| |||||    
12470462 tgagttgaaagtgcaaataaaggttgagggtatgcaataaaaaaaactaagggggttcatagtgcaaaaaaaattggattattggtgtatttttcaaaag 12470363  T
108 ttgagaggatgcatgtgcatcccctaacttgtatgtggctccgccactg 156  Q
    ||||||||||||||||||||||||| ||||||| |||||||||||||||    
12470362 ttgagaggatgcatgtgcatcccctgacttgtacgtggctccgccactg 12470314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 9 - 156
Target Start/End: Original strand, 34306471 - 34306618
Alignment:
9 tgagatgaaagtgcagataaaagttgagggtatgcaatnnnnnnnnctaagggggttcatagtgcnnnnnnnntggattattggtgtattttttaaaagt 108  Q
    |||| |||||||| | ||||| ||||||||||||||||        |||||||||||||||||||        |||||||||||||||||||| ||||||    
34306471 tgagttgaaagtgtaaataaaggttgagggtatgcaataaaaaaaactaagggggttcatagtgcaaaaaaattggattattggtgtatttttcaaaagt 34306570  T
109 tgagaggatgcatgtgcatcccctaacttgtatgtggctccgccactg 156  Q
    |||||||||||||||||||||||| ||||||| |||||||||||||||    
34306571 tgagaggatgcatgtgcatcccctgacttgtacgtggctccgccactg 34306618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 116 - 159
Target Start/End: Complemental strand, 8366265 - 8366222
Alignment:
116 atgcatgtgcatcccctaacttgtatgtggctccgccactggtt 159  Q
    |||||| |||||||||| ||||||||||||||||||||||||||    
8366265 atgcatctgcatcccctcacttgtatgtggctccgccactggtt 8366222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 82 - 157
Target Start/End: Complemental strand, 33829902 - 33829827
Alignment:
82 tggattattggtgtattttttaaaagttgagaggatgcatgtgcatcccctaacttgtatgtggctccgccactgg 157  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||||||    
33829902 tggattattggtgtatttttcaaaagttgagaggatgcatgtgcatcccctgacttgtacgtggctccgccactgg 33829827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 82 - 159
Target Start/End: Complemental strand, 37503456 - 37503380
Alignment:
82 tggattattggtgtattttttaaaagttgagaggatgcatgtgcatcccctaacttgtatgtggctccgccactggtt 159  Q
    ||||||||||||| ||||||  ||||||||| | ||||||||||||||||| ||||||| ||||||||||||||||||    
37503456 tggattattggtgcatttttctaaagttgag-gtatgcatgtgcatcccctgacttgtaggtggctccgccactggtt 37503380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 114 - 156
Target Start/End: Original strand, 24857354 - 24857396
Alignment:
114 ggatgcatgtgcatcccctaacttgtatgtggctccgccactg 156  Q
    |||||||| |||||||||| |||||||||||||||||||||||    
24857354 ggatgcatctgcatcccctcacttgtatgtggctccgccactg 24857396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 174 - 250
Target Start/End: Original strand, 31192373 - 31192448
Alignment:
174 tggggttttccccaaacccgcaaccnnnnnnnngcaaaatgttgtttctatcacagacaagaacacacgttgcgcgt 250  Q
    |||||||||||||||||||||||||        ||||||||||||||||| ||||||||||||||||| ||||||||    
31192373 tggggttttccccaaacccgcaaccaaaaaaa-gcaaaatgttgtttctaccacagacaagaacacacattgcgcgt 31192448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 116 - 156
Target Start/End: Complemental strand, 25267886 - 25267846
Alignment:
116 atgcatgtgcatcccctaacttgtatgtggctccgccactg 156  Q
    |||||| |||||||||| |||||||||||||||||||||||    
25267886 atgcatttgcatcccctcacttgtatgtggctccgccactg 25267846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 114 - 156
Target Start/End: Original strand, 8078499 - 8078541
Alignment:
114 ggatgcatgtgcatcccctaacttgtatgtggctccgccactg 156  Q
    |||||||| |||||||||| ||||||||||||| |||||||||    
8078499 ggatgcatctgcatcccctcacttgtatgtggcaccgccactg 8078541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 99 - 156
Target Start/End: Complemental strand, 21466471 - 21466414
Alignment:
99 ttttaaaagttgagaggatgcatgtgcatcccctaacttgtatgtggctccgccactg 156  Q
    ||||||||| | || ||||||| ||||||||||| |||| |||||||| |||||||||    
21466471 ttttaaaagatcaggggatgcaagtgcatcccctcacttatatgtggcaccgccactg 21466414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University