View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_high_166 (Length: 250)
Name: NF11745_high_166
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_high_166 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 5 - 250
Target Start/End: Original strand, 30587099 - 30587344
Alignment:
| Q |
5 |
gaggagcagagaaatgccagatcagaggcaagaaaggaagaactacgcagacaagaaatacaggttgtcttttgagtctttcttctcatcgtgtactatc |
104 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30587099 |
gaggtgcagagaaatgccagatcagaggcaagaaaggaagaactacgcagacaagaaatacaggttgtcttttgagtctttcttctcatcgtgtactatc |
30587198 |
T |
 |
| Q |
105 |
tttctacgagggtagattatgtaggggtttcattgaagcagagcaaagttagtcttcttgcactctgttcattggtgggggtggaagcagctgtagaggc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30587199 |
tttctacgagggtagattatgtaggggtttcattgaagcagagcaaagttagtcttcttgcactctgttcattggtgggggtggaagcagctgtagaggc |
30587298 |
T |
 |
| Q |
205 |
caaattattctaaatccaaaggctgtcctcactattttgtatctct |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30587299 |
caaattattctaaatccaaaggctgtcctcactattttgtatctct |
30587344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University