View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_high_172 (Length: 248)
Name: NF11745_high_172
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_high_172 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 16 - 243
Target Start/End: Complemental strand, 10479213 - 10478983
Alignment:
| Q |
16 |
gtacctcccatttgattttttagtcaaatttcgtcataattttaagaagttttccacgaagggctgctgccttggtaaccttaatccactcataactact |
115 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10479213 |
gtacctcccttttgattttttagttaaatttcgtcataattttaagaagttttccacgaagggctgccgccttggtaaccttaatccactcataactact |
10479114 |
T |
 |
| Q |
116 |
taattatatggtgatgtttagtgtgcaaagtgtagcatttgcttgaatatatgccattatgtttc---tattgctaagtgccgcataatttttggtatga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10479113 |
taattatatggtgatgtttagtgtgcaaagtgtagcatttgcttgaatatatgccatgatgtttctattattgctaagtgccgcataatttttggtatga |
10479014 |
T |
 |
| Q |
213 |
gatggtatccttttttcagcatttacctttg |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |
|
|
| T |
10479013 |
gatggtatccttttttcagcatttacttttg |
10478983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University