View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_high_204 (Length: 238)
Name: NF11745_high_204
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_high_204 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 35501843 - 35502066
Alignment:
| Q |
1 |
aaagtgtagctaggctgagtgattcaaaatgaattgcctttactctttttctttggttacataaaatttagggtgagtcgaaggtgtttcggtgtacggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35501843 |
aaagtgtagctaggctgagtgattcaaaatgaattgcctttactctttttctttggttacataaaatttagggtgagtccaaggtgtttcggtgtacggt |
35501942 |
T |
|
| Q |
101 |
agagaaaccttatggcacaaatataaacttaattttgctctaactacattggtgtgacacggttggttgataactgagtcttaatattactctaactaaa |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35501943 |
agagtaaccttatggcacaaatataaacttaattttgctctaactacattggtgtgacacggttggttgataaatgagtcttaatattactctaactaaa |
35502042 |
T |
|
| Q |
201 |
ctaacatggtgtggcgcagtttgt |
224 |
Q |
| |
|
||||||||||||| |||||||||| |
|
|
| T |
35502043 |
ctaacatggtgtgacgcagtttgt |
35502066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University