View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_high_209 (Length: 234)
Name: NF11745_high_209
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_high_209 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 214
Target Start/End: Original strand, 54424233 - 54424432
Alignment:
| Q |
15 |
agagaggtgaagtaattatgaacgagagtgcagaggtcttcatgtgatgtaacccaattaccagaattgtcacgaagcttctttaccatatttttacttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54424233 |
agagaggtgaagtaattatgaacgagagtgcagaagtcttcatgtgatgtaacccaattaccagaattgtcacgaagcttctttaccatatttttacttt |
54424332 |
T |
|
| Q |
115 |
tcctggctaacgctgaagcatgaaaaaagttgctgtttgtgtcaccgtctgcgagccaaaatatttttgaacgttgcttcctggagcaataaagaagcta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54424333 |
tcctggctaacgctgaagcatgaaaaaagttgttgtttgtgtccccgtctgcgagccaaaatatttttgaacgttgcttcctggagcaataaagaagcta |
54424432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 17 - 194
Target Start/End: Complemental strand, 20120621 - 20120444
Alignment:
| Q |
17 |
agaggtgaagtaattatgaacgagagtgcagaggtcttcatgtgatgtaacccaattaccagaattgtcacgaagcttctttaccatatttttacttttc |
116 |
Q |
| |
|
|||||||||||| |||||||| |||| || ||||||||||| | |||| ||||||| | ||| ||||||| |||||||||| |||||||| ||||| |
|
|
| T |
20120621 |
agaggtgaagtagttatgaacaagagcacaaaggtcttcatgcgccgtaatccaattaactgaactgtcacgtagcttctttattgtatttttatttttc |
20120522 |
T |
|
| Q |
117 |
ctggctaacgctgaagcatgaaaaaagttgctgtttgtgtcaccgtctgcgagccaaaatatttttgaacgttgcttc |
194 |
Q |
| |
|
||| | | ||||||||||||||||| ||||||||||||| || | ||||||||||| ||||| ||||| |||||| |
|
|
| T |
20120521 |
ctgacagatgctgaagcatgaaaaaatctgctgtttgtgtcccctttcgcgagccaaaaaattttcgaacgctgcttc |
20120444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 129 - 195
Target Start/End: Complemental strand, 30168342 - 30168276
Alignment:
| Q |
129 |
gaagcatgaaaaaagttgctgtttgtgtcaccgtctgcgagccaaaatatttttgaacgttgcttcc |
195 |
Q |
| |
|
||||| ||||| || ||||||||| ||||||| || | |||||||||||||||||||| ||||||| |
|
|
| T |
30168342 |
gaagcgtgaaagaacttgctgtttatgtcaccctcagatagccaaaatatttttgaacgctgcttcc |
30168276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University