View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11745_high_213 (Length: 231)

Name: NF11745_high_213
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11745_high_213
NF11745_high_213
[»] chr3 (1 HSPs)
chr3 (14-169)||(39934698-39934853)


Alignment Details
Target: chr3 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 14 - 169
Target Start/End: Complemental strand, 39934853 - 39934698
Alignment:
14 agatgaaagacatgtttataaaggagggcttaattctccaagtgattgaaaccgatagggatcttgctttcatgatagtcattgaaattgtatttccaga 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||    
39934853 agatgaaagacatgtttataaaggagggcttaattctccaagtgattgaaaccgatagggatcttgctttgatgatagccattgaaattgtatttccaga 39934754  T
114 tactgttaatttgctttgttcgtttcacataaacaaaaatgttggtgcaacttgac 169  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39934753 tcctgttaatttgctttgttcgtttcacataaacaaaaatgttggtgcaacttgac 39934698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University