View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_high_219 (Length: 228)
Name: NF11745_high_219
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_high_219 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 17 - 218
Target Start/End: Original strand, 19031761 - 19031964
Alignment:
| Q |
17 |
gttgaagaaagttgctattgcaattgttgtcttacccattcctcccatcccataaatctatcatatgtactccatcataat--ggatccactcttgtctt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| || ||||||||||||||||| |
|
|
| T |
19031761 |
gttgaagaaagttgctattgcaattgttgtcttacccattcctcccatcccataaatctattatatgtactccatcatcatatggatccactcttgtctt |
19031860 |
T |
 |
| Q |
115 |
atgataatagagtcgcatgataggaatcttggatcggaggattaggtaaaacaactattgctttaggctttataaataaattattattttatttgatttc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
19031861 |
atgataatagagtcgcatgataggaatcttggatcggaggattaggtaaaacaactattgcattaggctttataaataaatcattcttttatttgatttc |
19031960 |
T |
 |
| Q |
215 |
tcat |
218 |
Q |
| |
|
|||| |
|
|
| T |
19031961 |
tcat |
19031964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University