View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_high_227 (Length: 216)
Name: NF11745_high_227
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_high_227 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 56343045 - 56343108
Alignment:
| Q |
20 |
gttgggacccgctcctcctttttcagatattcaaatccaagaacaacaatccctccccctcttc |
83 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
56343045 |
gttgggacccgctcctcctttttcagaaattcaaatccaagaacaacaatccctccccctcttc |
56343108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 204
Target Start/End: Original strand, 56343180 - 56343229
Alignment:
| Q |
155 |
gatgactctggagatgattattctaactccatttccggtgcttcttctct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56343180 |
gatgactctggagatgattattctaactccatttccggtgcttcttctct |
56343229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University