View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11745_high_227 (Length: 216)

Name: NF11745_high_227
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11745_high_227
NF11745_high_227
[»] chr4 (2 HSPs)
chr4 (20-83)||(56343045-56343108)
chr4 (155-204)||(56343180-56343229)


Alignment Details
Target: chr4 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 56343045 - 56343108
Alignment:
20 gttgggacccgctcctcctttttcagatattcaaatccaagaacaacaatccctccccctcttc 83  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
56343045 gttgggacccgctcctcctttttcagaaattcaaatccaagaacaacaatccctccccctcttc 56343108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 155 - 204
Target Start/End: Original strand, 56343180 - 56343229
Alignment:
155 gatgactctggagatgattattctaactccatttccggtgcttcttctct 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
56343180 gatgactctggagatgattattctaactccatttccggtgcttcttctct 56343229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University