View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_high_229 (Length: 214)
Name: NF11745_high_229
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_high_229 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 10306577 - 10306775
Alignment:
| Q |
1 |
ccgattcaacaccaccgcgatcaccacaaccaccgccaccattgacgatgattgttactgagtcgcctccagcttcactaaacatcgactcactccctcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10306577 |
ccgattcaacaccaccgcgatcaccac---------caccattgacgacgattgttactgagtcgcctccagcttcactaaacatcgactcactccctcc |
10306667 |
T |
|
| Q |
101 |
gattcctttccatttcacctccgattcaacaccaccgccgtcgcaaccacctccaccggcgcgggaaatacaacgagcaatcgattcacttcctacgttt |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||||||||||||| ||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10306668 |
gattccgttccatttcacctccgattcaacaccaccgtcgtcgcaaccacctcaacctgcgccggaaatacaacgagcaatcgattcacttcctacgttt |
10306767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University