View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_high_236 (Length: 207)
Name: NF11745_high_236
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_high_236 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 19 - 205
Target Start/End: Original strand, 39076701 - 39076888
Alignment:
| Q |
19 |
atatgagaagttgcatcacttccaactttgatgg-caaacatctaaagttaaaatgcagttggtatgttttatgcatgctgtgaaaacttaatgttagta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076701 |
atatgagaagttgcatcacttccaactttgatggtcaaacatctaaagttaaaatgcagttggtatgttttatgcatgctgtgaaaacttaatgttagta |
39076800 |
T |
|
| Q |
118 |
tggtcataataattggcagaagacagttttgtgagagtacttctgatttctgagacctatgcactataaattaaccctttctctctgc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076801 |
tggtcataataattggcagaagacagttttgtgagagtacttctgagttctgagacctatgcactataaattaaccctttctctctgc |
39076888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University