View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_high_242 (Length: 202)
Name: NF11745_high_242
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_high_242 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 19 - 188
Target Start/End: Original strand, 8161555 - 8161724
Alignment:
| Q |
19 |
tctaattgattttggataagcagggacaaaaatgttcttttgattcagtagaaccaccttgttcacttctgggtccgttgaaattatcacattgcttccc |
118 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8161555 |
tctaattgattttggataagcagggataaaattgttcttttgattcagtagaaccaccttgttcacttctgggtccgttgaaattatcacattgcttccc |
8161654 |
T |
|
| Q |
119 |
aaaatgtttgtcttaaacacattcccataactgcatttacatatacaaaatgtaaataaaaacacctttg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8161655 |
aaaatgtttgtcttaaacacattcccataactgcatttacatatacaaaatgtaaataaaaacacgtttg |
8161724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University