View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_high_244 (Length: 201)
Name: NF11745_high_244
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_high_244 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 183
Target Start/End: Original strand, 38278464 - 38278629
Alignment:
| Q |
18 |
ggatttccattgtatctctgaagcaactgacatcaaattcataggtggctttgccattccacagccagtaccaccaaaaccgccggataatgacacatcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
38278464 |
ggatttccattgtatctctgaagcaactaacatccaattcataggtggctttgccattccacagccagtaccaccaaaaccgccggataataacccatct |
38278563 |
T |
 |
| Q |
118 |
aagtatgcccttgtgtcgttatcgatcactatcactgaaccatatgatcctggtccatcaaaatct |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38278564 |
aagtatgcccttgtgtcgttatcgatcactatcactgaaccatatgatcctggtccatcgaaatct |
38278629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 20 - 180
Target Start/End: Original strand, 38270579 - 38270738
Alignment:
| Q |
20 |
atttccattgtatctctgaagcaactgacatcaaattcataggtggctttgccattccacagccagtaccaccaaaaccgccggataatgacacatccaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||||||||||| |||||||| |||||| |||||||||| ||| ||||||| || |||| || |
|
|
| T |
38270579 |
atttccattgtatctctgaagcaactaacatccaattcataggtggcttcgccattccgcagccaccaccaccaaaa-cgcaggataataacgcatctaa |
38270677 |
T |
 |
| Q |
120 |
gtatgcccttgtgtcgttatcgatcactatcactgaaccatatgatcctggtccatcaaaa |
180 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||| ||||||||| ||| |||||||||||| |
|
|
| T |
38270678 |
gtatacccttgcgtcgttatcgatcactatcactaaaccatatgttccaggtccatcaaaa |
38270738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 38274606 - 38274656
Alignment:
| Q |
18 |
ggatttccattgtatctctgaagcaactgacatcaaattcataggtggctt |
68 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||| |||||||||||||||| |
|
|
| T |
38274606 |
ggatttccattgtatctctgaagtaactaacatccaattcataggtggctt |
38274656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University