View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_high_40 (Length: 491)
Name: NF11745_high_40
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_high_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 421; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 421; E-Value: 0
Query Start/End: Original strand, 6 - 475
Target Start/End: Original strand, 45144031 - 45144506
Alignment:
| Q |
6 |
agcagcacagatataatatcccttcacaaacactctcggcggaatcaccatcttctctttcagaagctccctcagttcctctttaaacccactatccatc |
105 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45144031 |
agcaccaccgatataatatcccttcacaaacactctcggcggaaccaccatcttctctttcagaagctccctcagttcctctttaaacccactatccatc |
45144130 |
T |
 |
| Q |
106 |
gaaacgtcacgctcgcatatttgtacaccaaatgcatcaaaagctgctctcaccgcattgcaagcctcaaatgtcctccgaacacctctcaacgttgttg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45144131 |
gaaacgtcacgctcgcatatttgtacaccaaatgcatcaaaagctgctctcaccgcattgcaagcctcaaatgtcctccgaacacctctcaacgttgttg |
45144230 |
T |
 |
| Q |
206 |
tatagatcaccactttcttctctccgtttggtggacatatcctctcaaaccgatccgaaagcgtcgaaccgggttttttcaaagcag------ggtttag |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| ||||||| |
|
|
| T |
45144231 |
tatagatcaccactttcttctctccgtttggtggacatatcctctcaaaccgatccgaaagcgtccaaccaggttttttcaaagcagggtttaggtttag |
45144330 |
T |
 |
| Q |
300 |
gtttagatttaggtttgggttggtgttttctttgtgagagggttttgatgatggtggagttaggggtgagaagcggaagctttcggtgtcgaggccttcc |
399 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45144331 |
gtttaggtttaggtttggattggtgttttctttgtgagagggttttgatgatggtggagttaggggtgagaagcggaagctttcggtgtctaggccttcc |
45144430 |
T |
 |
| Q |
400 |
atgagttcccaagagttaatgatttcaggcggtggaggaggaggagtggtggttgtgggtggatcaagggtgttga |
475 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45144431 |
atgagttcccaagagttaatgatttcaggcggtggaggaggaggagtggtggttgtgggtggatcaagggtgttga |
45144506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University