View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_high_60 (Length: 415)
Name: NF11745_high_60
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_high_60 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 9 - 337
Target Start/End: Complemental strand, 20710688 - 20710359
Alignment:
| Q |
9 |
accggaaggattttatttgcttcgaaagagctaaagaggcttgctatagtgttcctatgccattgtcttgtaactggatcaatcgaatcttccacttttg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20710688 |
accggaaggattttatttgcttcgaaagagctaaagaggcttgctatagtgttcctatgccattgtcttgtaactggatcaatcgaatcttccacttttg |
20710589 |
T |
 |
| Q |
109 |
catcatcctacagccccgagccgaggaattttgagaggagttgtccctggtccatggcccacttatatttacaaatcttgattttgtcccctttgccaat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
20710588 |
catcatcctacagccccgagccgaggaattttgagaggagttgtccctggtccgtggcccacttatatttacaaatcttgactttgtcccccttgccaat |
20710489 |
T |
 |
| Q |
209 |
gatccatcttcaaccttgctcaccagtatccttagtattacaaatgcttctcaacacataacttggattacagccggg-tttgcttctaaaaatggtttg |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20710488 |
gatccatcttcaaccttgctcaccagtatccttagcattacaaatgcttctcaacacataacttggattacagccgggatttgcttctaaaaatggtttg |
20710389 |
T |
 |
| Q |
308 |
cttgagcaatatctgctacacataactttt |
337 |
Q |
| |
|
|||||| |||||| |||||||||||||||| |
|
|
| T |
20710388 |
cttgagtaatatcagctacacataactttt |
20710359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 72 - 271
Target Start/End: Complemental strand, 29464620 - 29464421
Alignment:
| Q |
72 |
tgtcttgtaactggatcaatcgaatcttccacttttgcatcatcctacagccccgagccgaggaattttgagaggagttgtccctggtccatggcccact |
171 |
Q |
| |
|
||||||||| ||||||||||| | ||||| ||||| || ||||| | ||| |||||||| | ||||| |||||| || || ||||| ||| ||||| |
|
|
| T |
29464620 |
tgtcttgtagctggatcaatcaattcttcaactttcgcgtcatcttgcagacccgagcccggaggttttgtgaggagatggccatggtctgtgggccact |
29464521 |
T |
 |
| Q |
172 |
tatatttacaaatcttgattttgtcccctttgccaatgatccatcttcaaccttgctcaccagtatccttagtattacaaatgcttctcaacacataact |
271 |
Q |
| |
|
||| ||| |||||||||| ||||||||| ||||||||||||||||||| ||| ||||| | ||||||||| | |||| ||||||||| ||| |||||| |
|
|
| T |
29464520 |
tatctttccaaatcttgactttgtcccccttgccaatgatccatcttccacccagctcaataatatccttagcaatacagatgcttctccacagataact |
29464421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University