View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_102 (Length: 346)
Name: NF11745_low_102
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_102 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 160 - 331
Target Start/End: Original strand, 42331698 - 42331871
Alignment:
| Q |
160 |
gtattgtcgaactagaagagagaaagnnnnnnn--gttaccaattccatttagatatcttgaaagcttcggacgtgtggataaagctgtgaggaatcata |
257 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42331698 |
gtattgtcgaactagaagagagaaagaaaaaaaaagttaccaattccatttagagatcttgaaagcttcggacgtgtggataaagctgtggggaatcata |
42331797 |
T |
 |
| Q |
258 |
ttcatgctcttaaaactgagtctccattgagcgacgtaacccacagattccacttcgaatggagagtaaaacat |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42331798 |
ttcatgctcttaaaactgagtctccattgagcgacgtaacccacagattccacttcgaatggagagtaaaacat |
42331871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 16 - 58
Target Start/End: Original strand, 42331554 - 42331596
Alignment:
| Q |
16 |
agggaatccctcgagaatgatatgtgccttcgtgttgggaagt |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42331554 |
agggaatccctcgagaatgatatgtgccttcgtgttgggaagt |
42331596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University