View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_106 (Length: 342)
Name: NF11745_low_106
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_106 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 3e-73; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 180 - 327
Target Start/End: Original strand, 2069117 - 2069264
Alignment:
| Q |
180 |
gaaggttgaatggtacaactcaactgcccttgtgttcccccttggagcaagtgttataggcctccttccgagcaatgattgattttcttctcacgattgt |
279 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2069117 |
gaaggttgaatggtacaactcaaccgcccttgtgttcccccttggagcaagtgttataggcctccttcggagcaatgattgattttcttctcacgattgt |
2069216 |
T |
 |
| Q |
280 |
tggatagataaggggtgaatgatgttaacggtccaaagccaaatcttg |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2069217 |
tggatagataaggggtgaatgatgttaacggtccaaagccaaatcttg |
2069264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 194 - 327
Target Start/End: Original strand, 2073477 - 2073610
Alignment:
| Q |
194 |
acaactcaactgcccttgtgttcccccttggagcaagtgttataggcctccttccgagcaatgattgattttcttctcacgattgttggatagataaggg |
293 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2073477 |
acaactcaaccgcccttgtgttcccccttggagcaagtgttataggcctccttcggagcaatgattgattttcttctcacgattgttggatagataaggg |
2073576 |
T |
 |
| Q |
294 |
gtgaatgatgttaacggtccaaagccaaatcttg |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2073577 |
gtgaatgatgttaacggtccaaagccaaatcttg |
2073610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 9 - 99
Target Start/End: Original strand, 2068939 - 2069029
Alignment:
| Q |
9 |
agcataggtggaaaatttgaagatcccaaattaagtagacacctctaaagaaccctcatcttctgtctctcacttacaagatatattatta |
99 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||| ||||||| |||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
2068939 |
agcataagtggaaaatttgaagatcccaaattaggtaaacacctccaaagaaccctcatcctctctctctcacttataagatatattatta |
2069029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University