View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_123 (Length: 318)
Name: NF11745_low_123
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_123 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 16 - 303
Target Start/End: Complemental strand, 21400366 - 21400079
Alignment:
| Q |
16 |
gatgtgttatacttgccagtttcttaatgtcaatttgatattcatagacaaggtagcaaaggaattgtcttgttctctgatgcaagttgtttgatacaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21400366 |
gatgtgttatacttgccagtttcttattgtcaatttgatattcatagacaaggtagcaaaggaattgtcttgttctctgatgcaagttgtttgatacaga |
21400267 |
T |
|
| Q |
116 |
tcaccaatgacttgaagatgattggtttgggtagattacacaatgtgctttactacttggaagatagtagagatgtaaataaccatgctgctccatgtac |
215 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21400266 |
tcaccaaggacttgaagatgattggtttgggtagattacacaatgtgctttactacttggaagatagtagagatgtaaataaccatgctgctccatgtac |
21400167 |
T |
|
| Q |
216 |
aactaaaaatggagttctaaataagcctgctactatatgcataactagttgtaatctgctttctattcctgattctgctctatgccac |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21400166 |
aactaaaaatggagttctaaataagcctgctactatatgcataactagttgtaatctgctttctattcctgattctgctctatgccac |
21400079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University