View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_124 (Length: 317)
Name: NF11745_low_124
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_124 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 37492418 - 37492550
Alignment:
| Q |
1 |
acacatgaataatagatgaatcacataatgaaattgtacagattcatttccaataatctttattgaaaaacaaagtattgaattagttgatcatcaatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37492418 |
acacatgaataatagatgaatcacattatgaaattgtacatattcatttccaataatctctattgaaaaacaaagtattgaattagttgatcatcaatat |
37492517 |
T |
|
| Q |
101 |
tagatgaatgtaaatatacaatggtcctcatag |
133 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
37492518 |
tagatgaatgtaaatatacaatggtactcatag |
37492550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 215 - 295
Target Start/End: Original strand, 37492732 - 37492812
Alignment:
| Q |
215 |
gggacaaccaaaattcattttatataggaattaaactccatattattgtcggacnnnnnnnngatagcacaacataaacaa |
295 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37492732 |
gggacaaccaaaattcattttatattggaaataaactccatattattgtcggacaaaaaaaagatagcacaacataaacaa |
37492812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University