View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11745_low_128 (Length: 309)

Name: NF11745_low_128
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11745_low_128
NF11745_low_128
[»] chr3 (2 HSPs)
chr3 (8-106)||(28672781-28672877)
chr3 (259-298)||(28673326-28673365)


Alignment Details
Target: chr3 (Bit Score: 84; Significance: 6e-40; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 8 - 106
Target Start/End: Original strand, 28672781 - 28672877
Alignment:
8 aatttatattgcgcagctatctcgaacagtacaaaactctgtgtgtcagaaaatatatgtacatttgaattgtttaaagagcatatcttacttgaacac 106  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||  |||||||||||||||||||||||||||||||||||||||||||||    
28672781 aatttatattgcgcagctatctcgaacagtacaaaactctgtgtatcagaaa--atatgtacatttgaattgtttaaagagcatatcttacttgaacac 28672877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 259 - 298
Target Start/End: Original strand, 28673326 - 28673365
Alignment:
259 gtagtatttcttttgtttaactgcaataacttgtctgtgc 298  Q
    ||||||||||||||||||||||||||||||||||||||||    
28673326 gtagtatttcttttgtttaactgcaataacttgtctgtgc 28673365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University