View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_128 (Length: 309)
Name: NF11745_low_128
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_128 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 6e-40; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 8 - 106
Target Start/End: Original strand, 28672781 - 28672877
Alignment:
| Q |
8 |
aatttatattgcgcagctatctcgaacagtacaaaactctgtgtgtcagaaaatatatgtacatttgaattgtttaaagagcatatcttacttgaacac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28672781 |
aatttatattgcgcagctatctcgaacagtacaaaactctgtgtatcagaaa--atatgtacatttgaattgtttaaagagcatatcttacttgaacac |
28672877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 259 - 298
Target Start/End: Original strand, 28673326 - 28673365
Alignment:
| Q |
259 |
gtagtatttcttttgtttaactgcaataacttgtctgtgc |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28673326 |
gtagtatttcttttgtttaactgcaataacttgtctgtgc |
28673365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University