View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_132 (Length: 302)
Name: NF11745_low_132
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_132 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 234
Target Start/End: Complemental strand, 29174971 - 29174754
Alignment:
| Q |
13 |
gaacggtcaagattaaaatactcttatctttatcatagtgtgctcccacaatgcagttcactcagttcatcctcaagcaaaggatgtttgactcaaggac |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29174971 |
gaacggtcaagattaaaatactcttatctttat----gtgtgctcccacaatgcagttcactcagttcatcctcaagcaaaggatgtttgactcaaggac |
29174876 |
T |
|
| Q |
113 |
ctatctgttgttgcacccactccgtcggtgaccaacaaattgatctccataatccaagacaaaattgaacaaaaaccataaaagcgtgataccaatcctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29174875 |
ctatctgttgttgcacccactccgtcgatgaccaacaaattgatctccataatccaagacaaaatcgaacaaaaaccataaaagcgtgataccaatcctg |
29174776 |
T |
|
| Q |
213 |
tacaaatctagaaggcatttaa |
234 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29174775 |
aacaaatctagaaggcatttaa |
29174754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University