View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_140 (Length: 287)
Name: NF11745_low_140
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_140 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 7 - 272
Target Start/End: Complemental strand, 54237753 - 54237488
Alignment:
| Q |
7 |
aagcagagaaaggggcatggcattggcagtgatggcatgtgtgtgggtcgggtcaccttttacttttcccaattcaaagcactttggtagagtcttttga |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54237753 |
aagctgagaaaggggcatggcattggcagtgatggcatgtgtgtgggtcgggtcaccttttacttttcccaattcaaagcactttggtagagtcttttga |
54237654 |
T |
 |
| Q |
107 |
gttttgaacaaagaaaaatataaaagcatatggcattgttgtttgtggaatgaaaataattaaagaatcaaattccaacaccaacggcatggaatggaag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54237653 |
gttttgaacaaagaaaaatataaaagcatatggcattgttgtttgtggaatgaaaataattaaagaatcaaattccaacaccaacggcatggaatggaag |
54237554 |
T |
 |
| Q |
207 |
aaagaagaataaacgcactccaatgaagattttatgtctgaaaggagaggcgattcccaccttact |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
54237553 |
aaagaagaataaacgcactccaatgaagattttatgtctgaaacaagaggcgattcccaccttact |
54237488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University