View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_150 (Length: 268)
Name: NF11745_low_150
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_150 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 90 - 256
Target Start/End: Original strand, 10306411 - 10306577
Alignment:
| Q |
90 |
tctcattccaccatcacttctctctctctaacctctttcgtttttctctccatggattcagtattctccaccattctcatcattctcgctattctcttca |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10306411 |
tctcattccaccatcacttctctctctctaacctctttcgtttttctctccatggattcagtattctccaccattctcatcattctcgctattctcttca |
10306510 |
T |
 |
| Q |
190 |
tcaccttcatgctttcactcatgctccgtttccttcaaatccgcataaatcgccgacgtctcctctc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10306511 |
tcaccttcatgctttcactcatgctccgtttccttcaactccgcataaatcgccgacgtctcctctc |
10306577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 66
Target Start/End: Original strand, 10306366 - 10306414
Alignment:
| Q |
18 |
caacactgtcattgcaaaacaacaacactcactatgtatcactgttctc |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10306366 |
caacactgtcattgcaaaacaacaacactcactatgtatcattgttctc |
10306414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University