View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_152 (Length: 266)
Name: NF11745_low_152
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_152 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 161 - 260
Target Start/End: Original strand, 41348686 - 41348785
Alignment:
| Q |
161 |
ttgagaggagatgaaaagtgcagtagataagagtgtgtcagcaaagagtggcaaacatgacagaaatggaacatgctccgatgccaagtattcatctcac |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41348686 |
ttgagaggagatgaaaagtgcagtagataagagtgtgtcagcaaagagtggcaaacatgacagaaatggaacatgctccgatgccaagtattcatatcac |
41348785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 25 - 104
Target Start/End: Original strand, 41348549 - 41348628
Alignment:
| Q |
25 |
gaaagaaattagaagccaataaaattctgttttattgcacttattttttatactatcggttagcttatctgtgttgtact |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41348549 |
gaaagaaattagaagccaataaaattctgttttattgcacttattttttatactatcggttagcatatctgtgttgtact |
41348628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University