View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11745_low_153 (Length: 266)

Name: NF11745_low_153
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11745_low_153
NF11745_low_153
[»] chr6 (2 HSPs)
chr6 (184-255)||(34899625-34899696)
chr6 (7-66)||(34899812-34899871)


Alignment Details
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 184 - 255
Target Start/End: Complemental strand, 34899696 - 34899625
Alignment:
184 ctatcatggatgatcgaaatgttgacgacgatgagaaggagtctttggccgggttgagttctgttccacctc 255  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
34899696 ctatcatggatgatcgaaatattgacgacgatgagaaggagtctttggccgggttgagttctgttccacctc 34899625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 7 - 66
Target Start/End: Complemental strand, 34899871 - 34899812
Alignment:
7 gccttacttcccggtcatcgatcctacgtacttccacctctctagggaacccctttagac 66  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
34899871 gccttacttcccggtcatcaatcctacgtacttccacctctctagggaacccctttagac 34899812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University