View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_156 (Length: 264)
Name: NF11745_low_156
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_156 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 31856666 - 31856417
Alignment:
| Q |
1 |
attcttgcagacccaacaatgggacatctaagtatttttcaaatgaaagtgatatcaacatttcttttaatcacttcagtaaaattggtttttggacaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31856666 |
attcttgcagacccaacaatgggacatctaagtatttttcaaatgaaagtgatatcaacatttcttttaatcacttcagtaaaattggtttttggacaga |
31856567 |
T |
|
| Q |
101 |
ttagtacaccttgcacaacttctatgattagtagtttcaccccatgtgcaaatttcattacaggaagcaccaattataatggtttaataacaccatcaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31856566 |
ttagtacaccttgcacaacttctatgattagtagtttcaccccatgtgcaaatttcattacaggaagcaccaattataatggtttaataacaccatcaag |
31856467 |
T |
|
| Q |
201 |
tagttgttgtgattcattacagtctatgatgagtactagtatggattgtg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31856466 |
tagttgttgtgattcattacagtctatgatgagtactagtatggattgtg |
31856417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 40 - 119
Target Start/End: Complemental strand, 31865670 - 31865591
Alignment:
| Q |
40 |
caaatgaaagtgatatcaacatttcttttaatcacttcagtaaaattggtttttggacagattagtacaccttgcacaac |
119 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||| ||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
31865670 |
caaatgaaagtgatatcaatatttcatttaatcacttcattaaaattggtttttgtacagattagtacacgttgcacaac |
31865591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University