View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_177 (Length: 250)
Name: NF11745_low_177
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_177 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 244
Target Start/End: Complemental strand, 44819339 - 44819113
Alignment:
| Q |
18 |
acaagttgatgtcgtggtttgtggttgtgaatagatatggcagtttcagtttcagagatagttggacttggaagcacttacggctattgcaacttatcgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44819339 |
acaagttgatgtcgtggtttgtggttgtgaatagatatggcagtttcagtttcagagatagttggacttggaagcacttacggctattgcaacttatcgc |
44819240 |
T |
 |
| Q |
118 |
gtttccggcggagggttaatgttacttcaccaaacacgaccttaatatcatcaattatcttccctacaaggaggaaatggtctagtgttgttgttcgagc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44819239 |
gtttccggcggagggttaatgttacttcaccaaacacgaccttaatatcatcaattatcttccctacaaggaggaaatggtctagtgttgttgttcgagc |
44819140 |
T |
 |
| Q |
218 |
tcagaactctagcacttattcatctca |
244 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
44819139 |
tcagaactctagcacttattcatctca |
44819113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University